SimpleSearch - Line and FST details


Line specific information

 
Line ID 233H06
Vector Used pAC161
Line Availability only available from NASC (N422362)
Segregation Analysis 100:39:26
Confirmed for Hit At3g03200
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g03200

 
Sequence (A. th genome BLAST matches underlined)
>48-K014315-022-233-H06-8409
CTGATCCATGTAGCATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCGCAGATA
TTGGATGACGTAAATTAAAATTATGATGCAATTAAGCTGGCATTCATGTTTTCATGAGTT
ACAATTTTATATTTAAACATTTTTAAAAATTATTTTGACATTTTAATTCCTAAAAGATTT
GGTGAAAATGATGAAAAAAATAATAAAATAGTTATTTACAGAGCTATGGGATCCTCCCTG
TAGTGAGA
GenBank Accession CR396422 [GenBank]
Graphic View Graphic view of gene At3g03200
Predicted Position of Insertion Chr3:737876 - go to primer design
BLAST e Value 4e-16
Hit Clone Code (BAC ID) T17B22
Hit Gene Code At3g03200 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 45
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03