SimpleSearch - Line and FST details


Line specific information

 
Line ID 235H03
Vector Used pAC161
Line Availability only available from NASC (N422551)
Segregation Analysis 100:84:60
Confirmed for Hit At1g73830
Parent of DUPLO pair 2298
Parent of pair(s) none

Gene hit At1g73830

 
Sequence (A. th genome BLAST matches underlined)
>24-K014334-022-235-H03-8409
TGTCGATCCATGTAGATTTCCCTGACATGAAGCCTTTACAATTGAATTATGGCTGCTATA
ACGGTAGTGTATTCTGCTTAACTGACTAACACATGTATATGAACATCTTTTATTGCATAG
ATATTGACTGACTGCGCACACTGTGGAAAGGCTACTATGCTTGAGGAGATAATTAATTAC
GTCCAGTCCTTACAAAATCAAGTCGAGGTATAACAATAACAATTAATTTCTCTTAAGTTA
TAGGTCATCTAACCAATTCCATTCTTTTCAATAATTATACTAATTTACTTTCTTTTTTAT
GTGAACTCAGTTTTTATCTATGAAGCTTACAGCAGCAAGTTCGTATTATGACTTTAACTC
GGAGACTGATGCTGTGGAATACATGCAGGTACAGAACCTATGGGATCCTCC
GenBank Accession AL938543 [GenBank]
Graphic View Graphic view of gene At1g73830
Predicted Position of Insertion Chr1:27760774 - go to primer design
BLAST e Value 1e-130
Hit Clone Code (BAC ID) F25P22
Hit Gene Code At1g73830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BR enhanced expression 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL938543 [GenBank]


Last Updated on 31.08.2016 09:40