SimpleSearch - Line and FST details


Line specific information

 
Line ID 240B10
Vector Used pAC161
Line Availability only available from NASC (N422966)
Segregation Analysis N/A (line seemingly not resistant, T2 plants grown without drug)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g11200

 
Sequence (A. th genome BLAST matches underlined)
>74-K014370-022-240-B10-8409
TGATCCATGTAGATTTCCCCGACATGAAGCACTTTACAATTGAATAGAAATGATATCGTA
TTATATATATACAGGGAGACTAGATACCGGTTGAGAATGGGCTTTACTTTAATGGGCCTA
TGGGATCCTCCCTATAGTGAG
GenBank Accession AL939008 [GenBank]
Graphic View Graphic view of gene At5g11200
Predicted Position of Insertion Chr5:3567154 - go to primer design
BLAST e Value 2e-15
Hit Clone Code (BAC ID) F2I11
Hit Gene Code At5g11200 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DEAD/DEAH box RNA helicase family protein
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 07.07.2016 14:03