SimpleSearch - Line and FST details


Line specific information

 
Line ID 240D06
Vector Used pAC161
Line Availability only available from NASC (N422986)
Segregation Analysis 100:79:56
Confirmed for Hit At5g44790
Parent of DUPLO pair 12600
Parent of pair(s) none
Note Although the line exists, the insertion in At1g16410 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g16410

 
Sequence (A. th genome BLAST matches underlined)
>44-K014370-022-240-D06-8409
TGATCCATGTAGATTTCCCGGACATGAAGCCCCCAAAACTCAAGACCGATCTTGCCATGC
TGCGCTCCTGCCCCCAAGAAGGCCCATCCTCGGCAATCTACCCGAACTATTCATGACTCG
TCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession CT026197 [GenBank]
Graphic View Graphic view of gene At1g16410
Predicted Position of Insertion Chr1:5608994 - go to primer design
BLAST e Value 1e-16
Hit Clone Code (BAC ID) F3O9
Hit Gene Code At1g16410 [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome p450 79f1
Insertion Classification CDSi
Confirmation Status failed

Gene hit At5g44790

 
Sequence (A. th genome BLAST matches underlined)
>91-K020163-022-240-D06t-8409
ATTTTCCTGGTGATTGCTGATCCTGTATATCATTGTTGTGGTGTGGGGTTCAAGTTATGT
TAATGAAAGTATGGTGACTGGTGAATCAGTTCCTGTATCAAAAGAGGTTGATTCACCAGT
AATCGGGGGTACTATTAATATGCATGGTGCTCTTCACATGAAAGCTACAAAGGTGGGATC
TGATGCAGTTCTGAGCCAGATTATTAGTTTGGTCGAGACCGCCCAAATGTCAAAAGCTCC
TATTCAGAAATTTGCGGATTATGTAAGTATATTAGATAAACATGTCAATAAGCGTGTCAT
CCATTGGTGTTATTGCTTGTTCCTTTGGGATATACTCATTAGCAAGGACACAAACTTACC
CTGGCTTGTCCAATTTTCAGGTTGCAAGTATTTTTGTTCCGGTAGTGATTACTTTGGCAT
TGTTCACCTTAGTAGGCTGGTAAGACCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX530843 [GenBank]
Graphic View Graphic view of gene At5g44790
Predicted Position of Insertion Chr5:18078024 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) K23L20
Hit Gene Code At5g44790 [TAIR] [MIPS] [SIGnAL]
Gene Annotation copper-exporting ATPase / responsive-to-antagonist 1 / copper-transporting ATPase (RAN1)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX530842 [GenBank]


Last Updated on 14.10.2014 10:23