SimpleSearch - Line and FST details


Line specific information

 
Line ID 240H04
Vector Used pAC161
Line Availability only available from NASC (N423032)
Segregation Analysis 50:31:24
Confirmed for Hit At5g39390
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g39390

 
Sequence (A. th genome BLAST matches underlined)
>19-K118533-0022-240-H04C-8409
CATTTCAATTGGTAATTTGTACATGATCATATATTCACTCATTGCTCATAGACTAAAGCT
CTGAAATCATTTCCTTGGGAATCAAGGCTTGAGCAAACTGTTATCAGTTTCGCAAGGTTA
CGGTGCCTAATACCTTTGAAAGATTCACATTCCGCTATAAAGCTTTTTGTTGCTCCATGT
TTCAGGAGGTTCAAAACTTTAACCGCGACGAGTTTTTCCTCGAGGCCAAGCAATCCTTTA
AACACATCACTGAAGTTGCCTGAACCAATTAGATTGCTTGAAGAGAAGCCACTTGTTGCA
TTATAAAGCTCTTCATAACTTATCTTCTCAAAAAACATCCCCACAGTAGTAGAATCAGAT
GGATTAGTATACTACCACTAACATCGTTCTTCTTCTGAAACCAAGA
GenBank Accession HG968838 [GenBank]
Graphic View Graphic view of gene At5g39390
Predicted Position of Insertion Chr5:15764453 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MUL8
Hit Gene Code At5g39390 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL939067 [GenBank] AL939066 [GenBank]


Last Updated on 14.10.2014 10:23