SimpleSearch - Line and FST details


Line specific information

 
Line ID 241B06
Vector Used pAC161
Line Availability only available from NASC (N423058)
Segregation Analysis 100:97:67
Confirmed for Hit At5g19530
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g19530

 
Sequence (A. th genome BLAST matches underlined)
>42-K014367-022-241-B06-8409
CTGATCCATGTAGCATTTCCCGGACATGAANGCACTTACAATTGAATATATCCTGCCAGC
ACTCAACACTGAAACTGAAACCGATACCCCTTTAAATATGCCGGTACGCCACACCATGAC
CATGAATGAATCTCGCATTCTCTTCACTATAAACTTCAGTCTCCTTCTCTATGGGATCCT
CCCTATAGTGAG
GenBank Accession AL939096 [GenBank]
Graphic View Graphic view of gene At5g19530
Predicted Position of Insertion Chr5:6589143 - go to primer design
BLAST e Value 4e-44
Hit Clone Code (BAC ID) T20D1
Hit Gene Code At5g19530 [TAIR] [MIPS] [SIGnAL]
Gene Annotation S-adenosyl-L-methionine-dependent methyltransferases superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23