SimpleSearch - Line and FST details


Line specific information

 
Line ID 241D05
Vector Used pAC161
Line Availability only available from NASC (N423081)
Segregation Analysis 65:15:11
Confirmed for Hit At4g09820
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At5g21170 can not be ordered because the confirmation of this insertion failed.

Gene hit At4g09820

Sequence (A. th genome BLAST matches underlined)
>36-K014371-022-241-D05-8409
TTTTTTTTACACCATAGAGAAAAGCATGAAGTATACCCACTAACTAACCCTCTGGGTTAT
GCATTTATGTTATCTCTCTTCATGCTTCTACTTTAGATAATCAATCACCAAACAATGAGA
ATCTCAACGGTCGCAATAATGTTCATGAAAATGTAGTGTGTGTACGTTTCATTAACTCTC
ATTTCTTTCTTATCCTATGGGATCCTCCCTTAAGTGAG
GenBank Accession BX511296 [GenBank]
Graphic View Graphic view of gene At4g09820
Predicted Position of Insertion Chr4:6183009 - go to primer design
BLAST e Value 1e-78
Hit Clone Code (BAC ID) F17A8
Hit Gene Code At4g09820 [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Appelhagen et al. 2011, tt8-6] [Rosso et al. 2003, tt8-GK01]
Other FSTs Supporting this Hit BX511295 [GenBank]

Gene hit At5g21170

 
Sequence (A. th genome BLAST matches underlined)
>04-K020163-022-241-D05t-8409
AGAGAGATATCATTAAGATCCGGACCAAAGGGATAAACAAGTGACTTGACGACCAAAAGT
TTATAATGATCCACTGTTTTTTCGATGATTTCTTTCAGAATATAAAAAACAAATGTGAAT
AAAAAGTTGGTTCAATGCCTTTGAGAAGGATAATGACACAAGGGCCATTCACCTCCTTGC
CACCGATTTGTGTGCCTTAACATCTCACTATGGGATCCTCCCTATAGTGAGATGNGAAGG
CCCNCNAATCTTCCGGATTTTTTTCCCTGTCCCAAAGGTACATATCCCCCTCGAAGTTAT
AAAACTGAATTTTTAATATTTTTGGATTATACTATACGGGACGAACTCCACCATTTTATT
GTGGATTTCCCTCCTCTTATTGACGCCTAGTAACCTATATATAAAGGGGGCGCGGATCTT
AATGATGACTCTTGCTCAAGAGCCCATTTTATACTAAGACTTTTTTCGATACGGGGATCC
TCAATGGTATCCTCCCTATAATGAGAGGGGCGTTTCGGGATATATTCAATTGTAAATGGC
TTCATGTCGGGAAAATCTACATGGATCAGCANTGAGTATGATGGTCAATAT
GenBank Accession BX530845 [GenBank]
Graphic View Graphic view of gene At5g21170
Predicted Position of Insertion Chr5:7205594 - go to primer design
BLAST e Value 3e-76
Hit Clone Code (BAC ID) T10F18
Hit Gene Code At5g21170 [TAIR] [MIPS] [SIGnAL]
Gene Annotation 5'-AMP-activated protein kinase beta-2 subunit protein
Insertion Classification TS2TE (5')
Confirmation Status failed, line belongs to a contamination group, please check line 082G07


Last Updated on 14.10.2014 10:23