SimpleSearch - Line and FST details


Line specific information

 
Line ID 242E12
Vector Used pAC161
Line Availability only available from NASC (N423196)
Segregation Analysis 50:38:20
Confirmed for Hit At2g14880
Parent of DUPLO pair 2312
Parent of pair(s) none

Gene hit At2g14880

 
Sequence (A. th genome BLAST matches underlined)
>93-K014395-022-242-E12-8409
CTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATTGCATCAAAACGA
CATCTTTCCGCAACCCATCAACTCCTCTGTCCTCTCTCCGGTTCGCCTCTCACCCGGCGG
CTAAACTACGCTTGGTTCGAGCGGTAACATCTGCGACGGAATCTTCAGAGCCAANCGCAA
CCAATAAGAGAGTGCCACGCGGTATCATGAAACCTATGGGATCCTCCC
GenBank Accession AL939886 [GenBank]
Graphic View Graphic view of gene At2g14880
Predicted Position of Insertion Chr2:6394805 - go to primer design
BLAST e Value 7e-89
Hit Clone Code (BAC ID) T26I20
Hit Gene Code At2g14880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SWIB/MDM2 domain superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR806378 [GenBank]


Last Updated on 07.07.2016 14:03