SimpleSearch - Line and FST details


Line specific information

 
Line ID 242H10
Vector Used pAC161
Line Availability only available from NASC (N423230)
Segregation Analysis 50:40:28
Confirmed for Hit At1g17830
Parent of DUPLO pair none
Parent of pair(s) 11134, 83657, 83660

Gene hit At1g17830

 
Sequence (A. th genome BLAST matches underlined)
>80-K014395-022-242-H10-8409
TTTGATTAATTAAATGCTGCGATTAATTGCATGTGGTGTATATTTATGAACAGTATTTAA
TATGTTGAGTGTAGTTAGCTTTATATAACATACACACATGGGCTTTAATTGTTTAAAAAG
CTACTTAAACTTTGATGTTAATTTGCAGAGCTGCAAGAATGATTTGAACAGTTTGTGGAT
CCATGAGAACAAAGATGAGATTGAATATTTCAGGCTTAGTGATCTTTGGGACTGTTTTGA
TGAGCCAAGCGCGTATGGACTTGGATCAAAGGTCGACTTAAACAATGGTGAATCCGTTAT
GCAGTACTATGTCCCGTATCTATCCGCCATTCAAATCTATACTAACAAATCTACAGCCAT
TCCTATGGGAT
GenBank Accession AL939926 [GenBank]
Graphic View Graphic view of gene At1g17830
Predicted Position of Insertion Chr1:6137560 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F2H15
Hit Gene Code At1g17830 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein of unknown function (DUF789)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL939925 [GenBank]


Last Updated on 14.10.2014 10:23