SimpleSearch - Line and FST details


Line specific information

 
Line ID 243B02
Vector Used pAC161
Line Availability only available from NASC (N423246)
Segregation Analysis 100:27:24
Confirmed for Hit At2g19170
Parent of DUPLO pair none
Parent of pair(s) 3945, 3970

Gene hit At2g19170

 
Sequence (A. th genome BLAST matches underlined)
>10-K014396-022-243-B02-8409
NATTGATCCATGTAGATTTCCCTGGACATGAAGCCTTTACCGGGAACCAAATTCGATCCA
GTTCCTTCTGCCATTCCAGGAATCCTGATTACAGATGTGTCCAAGTCAATGGTAATGAGA
GTTTTGATGCTTTCACTTACTCTTAGCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX890905 [GenBank]
Graphic View Graphic view of gene At2g19170
Predicted Position of Insertion Chr2:8315426 - go to primer design
BLAST e Value 5e-56
Hit Clone Code (BAC ID) T20K24
Hit Gene Code At2g19170 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation subtilisin-like serine protease 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g53510

 
Sequence (A. th genome BLAST matches underlined)
>10-K014389-022-243-B02-8409
CTGATCCATGTAGATTNTCCCGGACATGAAGCACTTTACACGGAAACTAATCTTATCTTC
TAATTTGTGACGCCGCAGGAATGATAGTAACAGACCCGCCACAGTTTCGTATGGCCAGAA
GAGATCCCATGACATATGTGCAACATTACTCTGAGTCCATGAGAGTAATAACATTATGAG
ATGTTCTCAATTTAACAAGTCATGAGAAAGTGTACACATTTGATCTATTTAATATTTATT
AACCAAAAAGGAAGCAAATCAATTATTTCGTTACGTGACGGTGGCATTAAGCATCTTGCA
TTGAATGATCCGGGATATATAATCTCAGGTTTCCCCTGGGTTGAAATGATGATATTAAAT
TTTAGGTTGACATGTACTTATCTTTGAAATAAAACAATTAAATATTTGAACTGACATGTC
TACGTTATATCATAAATAAACCAGGGGGTTTAATTAAATACCACGATTAACCCTTCTAGA
ATAAGGGAAAATGAATATTAATTCCGTCAATCACTATTATGTCGGGAAAACGATGCAATA
ATATTTAGTTTTCTTTTCTTATAACACCATACTTTAATTAGATTATCAAAATACTCCTTC
CTATTTTTATGTCGATGCGGAAAAGGTCCCCAAATCAAGCGCGACGAGCTAATGGACAAG
ACCCCACCCTTTTCATGGCGGAAAACCCGACAACCCGCAAAAAAGACAAAAGAACTGCAN
NTTTCATGGGCCGGGCGCGCTTCGGAGATCTCTCCAAATAGCACGGCGCCCGNCCCGTGG
GACACCCAACCCGCCAACACAAGGGAGACACACCGCCGGAGCCCACCGGACGGGGGGGGC
AGCAAACCTATGTGGACCA
GenBank Accession AL939948 [GenBank]
Graphic View Graphic view of gene At1g53510
Predicted Position of Insertion Chr1:19970382 - go to primer design
BLAST e Value 8e-135
Hit Clone Code (BAC ID) T3F20
Hit Gene Code At1g53510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation mitogen-activated protein kinase 18
Insertion Classification TS2TE (3')
Confirmation Status unknown


Last Updated on 31.08.2016 09:40