SimpleSearch - Line and FST details


Line specific information

 
Line ID 244D12
Vector Used pAC161
Line Availability only available from NASC (N423376)
Segregation Analysis 50:48:46
Confirmed for Hit At5g14870
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At5g06600 can not be ordered because the confirmation of this insertion failed.

Gene hit At5g06600

 
Sequence (A. th genome BLAST matches underlined)
>92-K014397-022-244-D12-8409
CTGATCCATGTAGATTTCCCTGACATGAANGCCTTTACACTTGAATATAGTCCTGAAATA
CATTCACCCTATCGAATCCTGCCTATAGTGACGAANNGAATGCCTCTACCCAGCTGTGCC
TTCGTTTATTGAATATGTCCAGAATAGACAGGTAATTCTACTAAGCACTGTTTCCTATGG
GATCCTCCCTATAGTGAGATACACACGGATCCAATTCTCCCCCCCGCCTTTTATATTCAT
TTCTATGGCACACACGCTTTTTCCCCCCCCCCCCCAACCCCCGCTCTCCCCCCGATCGGC
GGGGTTCACTCTAACCCCCCCCCATCATCCCCCCCCCTCTCTCCCCCCCCCCCATCTTCC
CCCCTCATTCAACACCCCATTACCTTCATACCCCTCCCACCGCGCCGTCCCCTCCTCTTT
TCTTCCCCCCGCCCCTTCCCCCCCTTCCCCCGCTTCCCATTCCCATTTCCCCCCCCCCCC
CTCCACTCCCGAATTTCCTTCACCCCATACCTCACCGCCCCACCACACATCCACCCCTTT
GCCGCTTGTCACTAACCTTCCCATCTCTACCCCTCTTTCCCCCCCCCCCCCCGTTCATAT
TCCCCCCTTCCTCATATCCCCCCTTTCCCTCCTCCATTATTTCCCCCCCCCTATTTTCTT
ATCACCCAATATCCCCCCCCCACCCCGACTAAACTTTTCCTCTACCCAACCCACCTCATA
ATCATCTCCCCTCCCTCCCCTTTTTTCTGCTCGCCCCTCTCCCCCCCTCCCTTCTTCTTT
TTTCCTTTACCCCCCCCACCTTTTCCACCCCCCCTTATCACTCCTCCGCCCCTCATATCA
TCTTCTCCCCATATTAATATCTCCTCCTCTCCCACCACCATATCC
GenBank Accession AL940106 [GenBank]
Graphic View Graphic view of gene At5g06600
Predicted Position of Insertion Chr5:2022107 - go to primer design
BLAST e Value 4e-35
Hit Clone Code (BAC ID) F15M7
Hit Gene Code At5g06600 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ubiquitin-specific protease 12
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 244E11

Gene hit At5g14870

 
Sequence (A. th genome BLAST matches underlined)
>12-K020162-022-244-D12t-8409
TCATCAAACATTCCGAATTTGAAATTGGTAGTGCTGCTTGTAGCATCACAATGAGAAAGG
ACCTGAGTAACGTTCTGCCAATACTGGCGCTCTGGTTGTTCTAAACTCTTGCAATCCAAG
AAGCTATGGGATCCTCCCTATAGTGAGATTCACGCATCTTATTTCTCCCTTTTCCACTTG
AAAGATAATGGTTCATTTTTCCTACTTTTGACCCCAGATGCATGACGCACCCTTGACTTT
TCCTTTTCCTTGTCACCGATTTTGTATTATCCACCATCCTATTTCTCTATCTACACTATA
CACTGACATATAGCTGATATATGGAATCTGACGAGGAACCCAGTTTCTACCCTTTGGCCA
TCACTCACAACTGCCCATTGGTCTTTGGAGACTGCATATTTGATATTTTCGCACTAGACA
AAAGAGTATTGTTCCATGATGTAGAAGAATAACTACTACTTGCTATTTATGCATAAAAGA
CTCCATATTAACTGTTCACCGGACTCTACCGATAGTGAGGATATGTCCTCTATTTTAATC
TTTAACTCCTTGCTAATTGGGAATCCTCTATGGTATACTCCATATA
GenBank Accession CT026199 [GenBank]
Graphic View Graphic view of gene At5g14870
Predicted Position of Insertion Chr5:4809712 - go to primer design
BLAST e Value 2e-62
Hit Clone Code (BAC ID) T9L3
Hit Gene Code At5g14870 [TAIR] [MIPS] [SIGnAL]
Gene Annotation cyclic nucleotide-gated channel 18
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23