SimpleSearch - Line and FST details


Line specific information

 
Line ID 244E08
Vector Used pAC161
Line Availability only available from NASC (N423384)
Segregation Analysis 50:6:5
Confirmed for Hit At4g23390
Parent of DUPLO pair none
Parent of pair(s) 67611, 96699, 96700

Gene hit At4g23390

 
Sequence (A. th genome BLAST matches underlined)
>61-K014390-022-244-E08-8409
ATGTAGGTTTGTAGGATAAACCTTAATAGATGGTTCTTGAGCAAAGATGATATAAGCTAT
GGGATCCTCCCTAAGTGAGACNCNCCNCCCTCCCTNTCCCTTCTTCTTTGTATTAAAAAT
GTTAGGCACCTCCCTCATACCAACATACACCACCCTCTCCCTTACTATTGTTTTATTTCT
AACCGTCCCCCGCCATTTTATCTCCCCCCCTCCACATTTTTTTTATCGCCCCCGCCTTTT
TTTTTACACCCCCCCCCCCTTTTCTTTTCATTTCGGGCCCCTCCGCCCAATTTTTCCCCT
CCAATCCGTTCCGCCGCCATACATTTCCCCCCCCCCCCTTTTGTCGGACACGAAACGGGC
CCCCCGCCCCCATATTCCTTTCTGCTTTTTTCCCCCCGGCCCCCGCGTTTAATCGCCCGC
GCCGATCAATTCCCCGCTTTCATATCGACCTTGGTTATTCTTCAGTTATTCTCTCCCCCG
CCTCCAGAATTTCCCCCGCCTCGTTCCCCTGTTCCCGCGGCACCGTCGGACTAAACCGCG
TTTCGCCGCGCCGAATACCCCCGTCAACATCCCAACCCGCGGCCGTTTCTTCTTTCCTAT
CCTCCCATTCCATGCCCATTATTTCCCCCCATCTGTCTCTTTCTCCTCGCCGCGATGACG
TTCGTCTTTCCTTTCTTTCGCCCTTCGCTTTTTACCCCATTCCCCCGCCCCCATTACGCA
TCCTGTCCCCGTGGGCCGGGTCGTCGCGCAAATTTCAGACTCACGTGGAAGAATCCGCCG
TACATCGCGTGTTGCACCCCTTGGACCGTTCGAGGCATTGCTTTCTCTCCTGCTCATCGC
TCCCCTCGCATAATTATCATTAGTCGCGTGCGTCCCACTCAGCCCTCTCTAATTTTTTTC
TCTTT
GenBank Accession AL940109 [GenBank]
Graphic View Graphic view of gene At4g23390
Predicted Position of Insertion Chr4:12219288 - go to primer design
BLAST e Value 4e-10
Hit Clone Code (BAC ID) F16G20
Hit Gene Code At4g23390 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NEP-interacting protein, putative (DUF239)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL940109 [GenBank]


Last Updated on 31.08.2016 09:40