SimpleSearch - Line and FST details


Line specific information

 
Line ID 244E11
Vector Used pAC161
Line Availability only available from NASC (N423387)
Segregation Analysis 50:46:34
Confirmed for Hit At5g06600
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g06600

 
Sequence (A. th genome BLAST matches underlined)
>85-K014390-022-244-E11-8409
ACTGTTAAAATGGTGTCTGTTTCTGGATACGGAAACTGCAAACTTTGTCATGATCCACAA
GATCAAAATATATATCCTTCCCAATTTGTTCCTTAAGGTCTTCATCTCTTGCAACCTTTC
ATGTTAACAAAGATTATGTTAGTAACGACAGTCTCAAAATAACACTCTGGAACAGTTCAA
AAGATATTATCAGGCCCAATTAAATAGGATAAACAAACCTTAATTATGGTATATAAGTGA
GCTTGTGCCTTGCATCTTCTTTTATCTTCCTTTTCTTCTTGCTCTTTCTTTAGCCTCACC
TGTCGAAATGTAATGAACGATCAGGTAAAACCAAGACGCATATAAACTACTTCAGAAAAT
GCCCGGAAATATTCTACCCCTTAATGCCCTGCTATGGCTTTCTCATCAACGTTGCAGATA
TTTTTATCTTTGACACTTTCTCGGATATTTACCAGCCTGTAAGCGTTCAAGTACCTTGGG
AATTTGGAAAGAGGGGTATTATTGCAACC
GenBank Accession AL940113 [GenBank]
Graphic View Graphic view of gene At5g06600
Predicted Position of Insertion Chr5:2023499 - go to primer design
BLAST e Value 5e-133
Hit Clone Code (BAC ID) F15M7
Hit Gene Code At5g06600 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ubiquitin-specific protease 12
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03