SimpleSearch - Line and FST details


Line specific information

 
Line ID 245F03
Vector Used pAC161
Line Availability only available from NASC (N423487)
Segregation Analysis 50:34:26
Confirmed for Hit At3g19760
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g19760

 
Sequence (A. th genome BLAST matches underlined)
>22-K014391-022-245-F03-8409
CTGATCCATGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATCTACCGCTGAGCAG
CTGTCGTCCGGGATTCTATCTTTCAAGATGGCATATATTGATGAATATATACTCATGGAT
AAGCCATTCATGTAGATACTCATTGCTCAATGTCTCTGAGAATCTTGATGTCGTCGCTTT
TAACAAAGTTGATTGCAACACTCTATGGGATCCTCCCTTTAGTGCAGACATAACGGTCGA
TTACCTTTGATGTTTCTGTGGGCTCTAATCAACCAACTTAAACTCTCGTG
GenBank Accession AL940235 [GenBank]
Graphic View Graphic view of gene At3g19760
Predicted Position of Insertion Chr3:6866272 - go to primer design
BLAST e Value 2e-24
Hit Clone Code (BAC ID) MMB12
Hit Gene Code At3g19760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation eukaryotic initiation factor 4A-III
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL940235 [GenBank]


Last Updated on 31.08.2016 09:40