SimpleSearch - Line and FST details


Line specific information

 
Line ID 246D12
Vector Used pAC161
Line Availability only available from NASC (N423568)
Segregation Analysis 50:32:32
Confirmed for Hit At1g30475
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g30475

 
Sequence (A. th genome BLAST matches underlined)
>92-K014446-022-246-D12-8409
CTGATCCATGTAGATTATCCCGGACATGATAGCCTTTACAATTGAACCAGTTGTCGTCTC
TACAATAAAAGACCTGTCTTTGCATGTAACTCTGCGCTGGTAGGTATCCATTCATGACTT
TGCAGCCTTTAAGTTTAAGTGTTTTAAATCTTTAGCTGTTGGGATAACTTCATCACACAC
CATTTTGCTCACATAACTTAATTACACATCATAAGCCATTTTGCTTGTTTTATGAACAAG
ATCCTTTTGCTCTTATGGCCGATAATAGTTTATTTTCCGGTATTCTCTTCCTAAGTGTCT
CTGAAACACTATGGGATCCTCCCTATTGTGA
GenBank Accession AL940311 [GenBank]
Graphic View Graphic view of gene At1g30475
Predicted Position of Insertion Chr1:10789287 - go to primer design
BLAST e Value 5e-133
Hit Clone Code (BAC ID) F26G16
Hit Gene Code At1g30475 [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL940310 [GenBank]


Last Updated on 14.10.2014 10:23