SimpleSearch - Line and FST details


Line specific information

 
Line ID 248D08
Vector Used pAC161
Line Availability only available from NASC (N423756)
Segregation Analysis 50:8:6
Confirmed for Hit At2g17370
Parent of DUPLO pair 713
Parent of pair(s) none

Gene hit At2g17370

 
Sequence (A. th genome BLAST matches underlined)
>60-K014443-022-248-D08-8409
TCATTTTCCGATCTTGCTTCCGATGATGATGTTTGGGTTAACGATGGGATGATTCTATGT
GATCAATCCCTAGAGAGAAACACCTCTTTAGTGAGGTACAACGGAACATGACGCGCGATG
GATGCTTTATGACAATGCGGATCTCCGGCGACACTGAAGATTCCATCTGGGTGCTCTCTA
GTCCCAAATCTACTACCGACATGGTGCACTGACCACGGTCAGAAGGAGGAAACTCGGTTA
TAATGGCGATGACATTGTTTTGGGCTCCTCAGTGCAACGTGAGCGATGACGCCAATAGGT
GGCGAGCGATACTTATAGAGTTGGGGGTGACGCCGAAAGACACCTCCAGGCTGTTGGGTC
ATCCTCGTGTGTGAGAGAGGAGACGACGAAGATACGCAGGTGATGATTTTGACTCCTCCG
TGACAATCTCACTGCGTCGTTTGTTATGTACACTATCGGGATGATTATTTAGGGTCATGG
GenBank Accession FR806478 [GenBank]
Graphic View Graphic view of gene At2g17370
Predicted Position of Insertion Chr2:7550299 - go to primer design
BLAST e Value 2e-24
Hit Clone Code (BAC ID) F5J6
Hit Gene Code At2g17370 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 3-hydroxy-3-methylglutaryl-CoA reductase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR806478 [GenBank]


Last Updated on 31.08.2016 09:40