SimpleSearch - Line and FST details


Line specific information

 
Line ID 249A09
Vector Used pAC161
Line Availability only available from NASC (N423817)
Segregation Analysis 50:27:22
Confirmed for Hit At3g06120
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g06120

 
Sequence (A. th genome BLAST matches underlined)
>65-K014444-022-249-A09-8409
NTTTGATCCATGTAGATCTTCCCGGACATGAATGCATTTACAATTGAATCTATCCTGATC
GATGCTATATGAGACCTTATCGGGCGGAAATGTATTGACTGACAATGTCTATAATTCTGC
TGTACATGAAGATCTTTACCTGAACAGCGCTTATGTCTTGACAGCCTGCTCCATGCTACT
AGTATTGAGGTGACGAACTTGATATAGATAGCGTATCTAACACAGAGATGATCTATACGA
GCTGCCTGACTATTCGTGTATGGAATCCCCATTGGAGAGAGGATCGGAAACTTACGGACG
CTGGCTGCAGTGACCTGGGGTTGTACCATGAATGAGTGCGTCTGATGATGNGATACGTCT
CTACCAATTAAAAACAAAATTCTACATGTGCTATCGCATGCTGCCTTTGGTGAGATCCAT
CATGATGAAAGGCGTCAATTGAGCCTTGGATCTCTGAGA
GenBank Accession AL940534 [GenBank]
Graphic View Graphic view of gene At3g06120
Predicted Position of Insertion Chr3:1847649 - go to primer design
BLAST e Value 2e-15
Hit Clone Code (BAC ID) F28L1
Hit Gene Code At3g06120 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40