SimpleSearch - Line and FST details


Line specific information

 
Line ID 249D03
Vector Used pAC161
Line Availability only available from NASC (N333563)
Segregation Analysis 30:2:1
Confirmed for Hit At5g51870
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g51870

 
Sequence (A. th genome BLAST matches underlined)
>20-K014444-022-249-D03-8409
CTGATCCATGGTAGATTTCCCGGNACATGAAGCCTTTACAGTTGATAAGATCTGGAAGGA
GATTTTCTTGCGCGAAGATCAAGATGATAACTCGAATAATGTTATGAAACTCATATGATC
CGAAACCTGATTGTGACTGTGGGATCCTACCTATAGTGAGGAGAACGTGACGAGCAGACA
AGTCACGTTCTCGAAGCGAAGAAGCGGTCTATTTAAGAAGGCTCATGAGCTTTCGGTTCT
ATGCGATGCTCAAGTAGCCGCCATTGTCTTTTCTCAGAGCGGAAGATTACACGAATACTC
TATGGGATCCTCCCTTAGGTGAG
GenBank Accession AL940563 [GenBank]
Graphic View Graphic view of gene At5g51870
Predicted Position of Insertion Chr5:21087992 - go to primer design
BLAST e Value 1e-74
Hit Clone Code (BAC ID) MIO24
Hit Gene Code At5g51870 [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 71
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23