SimpleSearch - Line and FST details


Line specific information

 
Line ID 250A11
Vector Used pAC161
Line Availability only available from NASC (N423915)
Segregation Analysis 100:21:19
Confirmed for Hit At1g35515
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g35515

 
Sequence (A. th genome BLAST matches underlined)
>81-K014486-022-250-A11-8409
GCAATGTTTACGTTTGCTAACAACCTCTCTCTATTCATTTTGCATGCTTTTAAAGAGAGA
AAGCATCTGAACTTCTTTTTCCGGCTTCTTAAGATCCTTTAGTGATTGATGGCCTGAGGT
CTGTCCATATTCGTATGGGTATCCACCCTGGATGGCTGGCTTTTGTCCGGCGATGTTTAG
GGCAACGTTTGATTGTCGTGGTTCTTCTGACACTGTTCGGTTCTTTACGACGATGGTCGG
TTTGCGTTTGGCTTCCATTGGCTTCTTTAGCGGCGGTAGGCTATGGGATCCTCCCTATAG
TGAG
GenBank Accession AL940634 [GenBank]
Graphic View Graphic view of gene At1g35515
Predicted Position of Insertion Chr1:13078577 - go to primer design
BLAST e Value 4e-72
Hit Clone Code (BAC ID) F15O4
Hit Gene Code At1g35515 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation high response to osmotic stress 10
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40