SimpleSearch - Line and FST details


Line specific information

 
Line ID 250C01
Vector Used pAC161
Line Availability only available from NASC (N423929)
Segregation Analysis 50:49:35
Confirmed for Hit At5g16080
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g16080

 
Sequence (A. th genome BLAST matches underlined)
>03-K014486-022-250-C01-8409
CTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAACATTTTAAATCTATTAGAG
GTTTCCTAGAAAGGTCGTGATGGAATTGTGAGAGAAGGATGTACGAAGCTGTGAAGACGA
CACATCATGACGGGGATTCGATCACGTGACGCCGACCAGTTGTCGGACATTGTGATTAGC
GGGACCAACACCTACATGAAGCATGCCTATAACTCTATTTCGACGGCTGCTCATCAATTT
ACTCTTCTGCAAGTGACAAACATTGAGTATATCAAACTCCGCCATGAACACCATCGTCGA
CGGTAACTTCGCTCCCGCCGAGCTCATCAGAGGGTTACCCATGGATGGTCTCTACTCGCT
CCACGTGGCAGAGCTATGGGATCCTCCCTTAAGGTGAG
GenBank Accession AL940650 [GenBank]
Graphic View Graphic view of gene At5g16080
Predicted Position of Insertion Chr5:5252482 - go to primer design
BLAST e Value 3e-66
Hit Clone Code (BAC ID) F1N13
Hit Gene Code At5g16080 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation carboxyesterase 17
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g52670

 
Sequence (A. th genome BLAST matches underlined)
>03-K014490-022-250-C01-8409
AATTTGATCCATGTAGACTTTCCCGGACATGAAGCCCTTTACAATTTGTTAATTCTGTCA
CAGGTACCCTAGGAAGGTCGTTATGGAATTGTGAGGAAGGATGCACGATGCTGTGAAGAC
GACACATCATGTCGGGGATTCGATCGCGTGACGCCGACCAGTTGATGGGCATTGTGCAAA
GCGGGACCAACACCTCCACGAAGCATGCCTTTAACTCTATCTCGACGGCTGCTCATCAAT
TTACTCTTCTGCAAATGACAAACATTGAGTATATCAAACTCCGCCATGAACACCATCGTC
GAAGGAAACTTCACTCCCGCCGAGCTTATCAGAGGGTTACGCCATGGATGGACTCTACTC
GCTCCACGTGGCAGAGCTAGAATAACCACTTAAGTTATCTGTCATACGGTGGTAATCTCA
TATTTTTTGTAGAATCCTTAAGAGTTGAGAACTTTCAAGAACAGTTAAGTTTAATAATAT
TTTAATCTTTGTATAAGAGATTTCTTCATTCTTTTAGAACCACCACACCTTGTGATCGAC
CATTCATACGTACCTATTCGAGATTTAATTTGTTTTTCCTTATATAACAAATCAATAATC
TTATTGAATATGACCAATTTATTAAATAAAAACCC
GenBank Accession AL940651 [GenBank]
Graphic View Graphic view of gene At1g52670
Predicted Position of Insertion Chr1:19617688 - go to primer design
BLAST e Value 1e-108
Hit Clone Code (BAC ID) F6D8
Hit Gene Code At1g52670 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Single hybrid motif superfamily protein
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 07.07.2016 14:03