SimpleSearch - Line and FST details


Line specific information

 
Line ID 250E06
Vector Used pAC161
Line Availability only available from NASC (N423958)
Segregation Analysis 50:33:28
Confirmed for Hit At4g27230
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g27230

 
Sequence (A. th genome BLAST matches underlined)
>51-K035338-022-250-E06C-8409
TTTCTGACAATGATATGACACTGCATGGATCGATAATCTACACCGTCAGATTGTTACAAG
TTTAAGGGACGTGATTTGAGATTCGTGCGCCCACCTGCTTTGTCCTTTTTTTGGTTCTCC
GATGATTTCAATGGATTGTTATATGGGCTATATTGGGCTTGTTAAATAGAAATACTCCTT
TTTATTTTAACGTTATCTGGCCCAAAATTTAACACTGTTCGGCCCAAATAAATTGTTTCT
TCACTTCTTGTACATATGTATTTTCCTTTTTATCAAAATTTCAAAGAAGTTAGGGAGAAG
TTATAACTTACTAAGTGTTGTAATGATTATTGTTTGCTTTTTAGACGTATTCTTTATGTG
GGTTTAAATTTGGATAATAACAGTTGCAAGTTGTATGACATATTGTGGTGGCTGAAAAGC
CCACAAATCTTCTCAGTTAGTAAGAACTCAAAAGTTGTAATATTAATTTAGACAACGTTA
CTTTCGTTGTTATCCATCTCCGGAGAAAACGTTACAATTTGTCAAAAAAGTATTAATGTC
AAGCTAATTT
GenBank Accession HG968845 [GenBank]
Graphic View Graphic view of gene At4g27230
Predicted Position of Insertion Chr4:13638469 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) M4I22
Hit Gene Code At4g27230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation histone H2A 2
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit HG968845 [GenBank]


Last Updated on 31.08.2016 09:40