SimpleSearch - Line and FST details


Line specific information

 
Line ID 251D02
Vector Used pAC161
Line Availability only available from NASC (N424038)
Segregation Analysis 50:20:19
Confirmed for Hit At1g14390
Parent of DUPLO pair 2681
Parent of pair(s) none

Gene hit At1g14390

 
Sequence (A. th genome BLAST matches underlined)
>20-K118533-0022-251-D02C-8409
ATTTCATTGAATATATGCATTTGAAGCTAAGGTATATGCATTGGTACTTATCAAGATCAT
CATCCTTATGCCGGAAGCACTATTTTCATTGTCCAAGAATATATCTCTAACGGGTCTTTG
AGGGATTACCTCACCGGTAATACTTGAAAAAGATTATCGATTTCAAGAACTTATATTTTT
GTTGGGAAACTAATTATTTGGAAATGTTTTTGGCAGATTGGAGAAAGAAAGAGGTGTTGA
AATGGCCTCAGAGAATGTCGATAGCGATTGGAGTTGCTCGAGGAATACAGTTCTTGCACA
CAGGAGTGGCACCAGGAATATTTGGGAACAATTTGGAAAATAGA
GenBank Accession HG968846 [GenBank]
Graphic View Graphic view of gene At1g14390
Predicted Position of Insertion Chr1:4925947 - go to primer design
BLAST e Value 4e-171
Hit Clone Code (BAC ID) F14L17
Hit Gene Code At1g14390 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL940749 [GenBank]

Gene hit At5g45220

 
Sequence (A. th genome BLAST matches underlined)
>12-K014555-022-251-D02-8409
TTGATCCATGGTAGATTTCCCGCACATGAANGCCTTTACAATTGAATATATCCTGATGGC
ACTGATGGCACCGATGGCACCGCCCTCACCCCTATGGGATCCTCCCTATAGTAGAGAAAG
TTCTCTATTCCAGCAATAAATTTTAGGAGCAAATGAATTTTGCAGAAAATAATACTTACA
TTAAACGTGTGCTCGGATAAGCACTTTGTTTCATAACAAAAAAGAGAACCAAAAGACAAC
CTATTACCATTCCTATGGGATCCTCCCTATAGNGAG
GenBank Accession AL940750 [GenBank]
Graphic View Graphic view of gene At5g45220
Predicted Position of Insertion Chr5:18300098 - go to primer design
BLAST e Value 6e-68
Hit Clone Code (BAC ID) K18C1
Hit Gene Code At5g45220 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Disease resistance protein (TIR-NBS-LRR class) family
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 14.10.2014 10:23