SimpleSearch - Line and FST details


Line specific information

 
Line ID 251D07
Vector Used pAC161
Line Availability only available from NASC (N424043)
Segregation Analysis 25:17:13
Confirmed for Hit At5g57710
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At1g67260 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g67260

 
Sequence (A. th genome BLAST matches underlined)
>52-K014552-022-251-D07-8409
CTGATCCATGTAGAATTTCCCGGACATGAAGCACTTTACAATTGAATATATACATGTAAA
CTCCTCTTATCTATTGGGGCGCATAATGACGCGATACAATGAGTATACTGAGCCTCATCT
ACTTTTGGCGATCGACGCAGCGGATGTGCACATCCCTGGACAGGCGGAACGCTCAGTAAA
CTATAATATCCGATTTGGTGTATCGAGATTGGTTATGAAATACCGATGCTATGGGATCCT
CCCATTAGTGAGATCCAAACTTTACCTTTGGGGAAATTTTTGTCGGTGACTACATATAAG
GTTTGGTCATGAAAAGGGTTTTGATCATAACTATAATCCAAATTTTGAGGCAGAAATGTA
TTATAGTTGCTGCTATGGGATCCTCCCTTAGGTGA
GenBank Accession AL940757 [GenBank]
Graphic View Graphic view of gene At1g67260
Predicted Position of Insertion Chr1:25168056 - go to primer design
BLAST e Value 3e-63
Hit Clone Code (BAC ID) F1N21
Hit Gene Code At1g67260 [TAIR] [MIPS] [SIGnAL]
Gene Annotation TCP family transcription factor
Insertion Classification TS2TE (3')
Confirmation Status failed

Gene hit At5g57710

 
Sequence (A. th genome BLAST matches underlined)
>52-K014555-022-251-D07-8409
CTGATCCACTGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCATGTGGA
CACATTATAACACGTTAGGGGTAAAAATAGTAAAAAAAAACGCGTTTATAGTCCTTTACT
TCTTTTTGTTTTACTCCCACCCTATGGGATCCTCCCTATAGTGAGACCTATGGGATCCTC
CCTATAGTGAG
GenBank Accession AL940758 [GenBank]
Graphic View Graphic view of gene At5g57710
Predicted Position of Insertion Chr5:23388142 - go to primer design
BLAST e Value 1e-07
Hit Clone Code (BAC ID) MRI1
Hit Gene Code At5g57710 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23