SimpleSearch - Line and FST details


Line specific information

 
Line ID 252D03
Vector Used pAC161
Line Availability only available from NASC (N424135)
Segregation Analysis 100:92:73
Confirmed for Hit At4g14690
Parent of DUPLO pair 1202
Parent of pair(s) none

Gene hit At4g14690

Sequence (A. th genome BLAST matches underlined)
>30-K119003-0022-252-D03C-8409
CATTTACATTGAATTATCCTGAAAAAGAAAGATTTAATACTATGAAGTTTTAACAGTGTG
TCAACATGAATCAAAATTTAAAACCATGAAAAAAACATTATAAAAATTTATTTGAAAAAG
TACTTCAAAAGTTTTCTTATAAGATAATGTGAATGGAGAAGAAGAAGTAAAAAATAAATT
TTAGCTTCTATCCAAGGTTTGAGAGTTTATGCATTCTTTTGAAATGAATCAAGAGCCAAG
AATAATTAATTATGCTCTTCCTTGTTATTATCGACCAATAGAGTCATCATGTGTCTGCCA
TAATGAAAGTAAAGCAAGTTCCAAGACGAAACGAAATTGAATGCGATTTCTCTCTAACAA
ATCACCTCATCTCAATTCTCAAGCCCATGGGTTAGTCTCATCAAAGCCCAATCAAAGCGT
CAATGCTTCCCAAGAACAAAAAAAAATATATTAAGATGAACAAACAAAAAAACACTTAAA
AGAGGAAAGATCTGGCCACTACAACACTACACGATAGTACGATCGATGAATATAATCGGA
AAGATTTGAGTGGCTCAATTACATATTGCTTATACGACGTCGTTTTGAGTAGCATCATTT
C
GenBank Accession LN713405 [GenBank]
Graphic View Graphic view of gene At4g14690
Predicted Position of Insertion Chr4:8419195 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g14690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Chlorophyll A-B binding family protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Casazza et al. 2005, elip2-1]
Other FSTs Supporting this Hit AL940843 [GenBank]


Last Updated on 31.08.2016 09:40