SimpleSearch - Line and FST details


Line specific information

 
Line ID 253B12
Vector Used pAC161
Line Availability only available from NASC (N424216)
Segregation Analysis 50:41:31
Confirmed for Hit At4g02050
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g02050

 
Sequence (A. th genome BLAST matches underlined)
>90-K014574-022-253-B12-8409
TTGATCCATGGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTCCAAAC
CCCATTGTCTGGAACAGAACAGGTGCGTAGAAGAGAAAGGAGTTTATCCCTGTGAGTATC
TGCAACATTGGCATGCAAATAGCCATAACTATGGGATGCTTCCGTGGGNNGAGTCGAGAG
AGTTGCTGAACGGTGGTATGCTGCATAAGGCNAGCTCACTCGCATCTACCGTGTCTTGAA
GCGCGGGGGATGACGTTCTCTGTACCTCATAGCCTTACTAAGACTCGGCGAACTGTCTGT
GGCCAATCCCTTTTCGACCAAAACTGTTTGGTGGCTCGGG
GenBank Accession AL940921 [GenBank]
Graphic View Graphic view of gene At4g02050
Predicted Position of Insertion Chr4:898972 - go to primer design
BLAST e Value 3e-45
Hit Clone Code (BAC ID) T10M13
Hit Gene Code At4g02050 [TAIR] [MIPS] [SIGnAL]
Gene Annotation sugar transporter protein 7
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23