SimpleSearch - Line and FST details


Line specific information

 
Line ID 253F04
Vector Used pAC161
Line Availability only available from NASC (N424256)
Segregation Analysis 50:41:38
Confirmed for Hit At4g12360
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g12360

 
Sequence (A. th genome BLAST matches underlined)
>30-K014574-022-253-F04-8409
CTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATATATGATGTATTC
TTTTTATCTATGATATAAACATATATATGAGACTTGTTTTAAAAGAGATAAATGGCATTT
AAGGCGACAACAACAACAATATTTGGCTATCTAATGTTTTAATGCATGTATTCTACAAAA
GTTATAACCAAAATGTTACCGGCTTTTTCCGAACACAATTTGGAATCAGTGGTGAGTCCA
CAAGTTTTGGAGAAAAGAGCATTGAAATCGGTGACATTGAAAGGGATCAACAACATTGGA
CTTTTGATGAAACCGCAAAGACAAGATAGCTGAGTTGTCAACGCCGTCTCTACGGCTGTG
CAGCATTCCTGCGACGGAGGTCCTCGCTGAGTAATTGCCGGAAGACAAACAGCCAAACCA
GCCGCACAGTTCATAGCTTCGTTGACTGAAGGACTATGAGACAGTCGATTTAGATGAGGC
CTGTCCTGAAACAGTCGTAGCTGCCACTATGGATGTGGCTATAGGATCCTGCCATTAGTC
GAGAGCAAAAAAT
GenBank Accession AL940963 [GenBank]
Graphic View Graphic view of gene At4g12360
Predicted Position of Insertion Chr4:7328598 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T4C9
Hit Gene Code At4g12360 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03