SimpleSearch - Line and FST details


Line specific information

 
Line ID 254G05
Vector Used pAC161
Line Availability only available from NASC (N424365)
Segregation Analysis 50:45:42
Confirmed for Hit At4g31360
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g31360

 
Sequence (A. th genome BLAST matches underlined)
>39-K014579-022-254-G05-8409
TTGATCCATGGTAGATTTCCCGGACATTGAAGCCTTTACAATTTGAATATATCCTGCTTG
CACTCTATGGGATCACCTTTCTAATAACGCTTGTAGGTTACAATCTGTACGCGTTTATTC
TAATTACTTTTCCTAGGTACCAAAAAAGCTGCACAAAAGGGAATTTTTTACATCACAATT
GTATTAATGAGCGGCATTACAGAGACGGAGAATAATGAGAATATTATTGTTACTACGATA
CCCTGTTGCTGTCCGTACTATGCCTTCGAAGAT
GenBank Accession AL941101 [GenBank]
Graphic View Graphic view of gene At4g31360
Predicted Position of Insertion Chr4:15221745 - go to primer design
BLAST e Value 3e-11
Hit Clone Code (BAC ID) F8F16
Hit Gene Code At4g31360 [TAIR] [MIPS] [SIGnAL]
Gene Annotation selenium binding
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23