SimpleSearch - Line and FST details


Line specific information

 
Line ID 255F07
Vector Used pAC161
Line Availability only available from NASC (N424451)
Segregation Analysis 100:71:56
Confirmed for Hit At4g21323
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g21323

 
Sequence (A. th genome BLAST matches underlined)
>54-K014576-022-255-F07-8409
CTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGATGAA
ATAGGCTGTCTGTCAACTCGGCGAATATGGAAAAGAATAAAAATGGCTAAATAAAAACAG
CGAATTGATGAAATAGGTAAAATTGAAGAAGGTTACTGCGAATTGATGAAGAAGCATCGA
ATTCCAGAAAAGACACGAAAGAGATTACTGCAAATGTTGCTAATTCGTCTTCGTCGTCGA
TCATCATTAACCTAAGCTTCTCTATTTCCTCTCTATCTTTTTTCTCTATTTTCCTTTTTG
TTATTGAAATAATTGCGAACGTAACCTAAATTTCGAGGTATCTAATTTGAGATCTTGTTA
ATAGTTCGAAATTAAACCCTAATTTTGTTGTTGCTATGGGATCCTC
GenBank Accession BX649801 [GenBank]
Graphic View Graphic view of gene At4g21323
Predicted Position of Insertion Chr4:11345891 - go to primer design
BLAST e Value 7e-95
Hit Clone Code (BAC ID) T6K22
Hit Gene Code At4g21323 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Subtilase family protein
Insertion Classification 3' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03