SimpleSearch - Line and FST details


Line specific information

 
Line ID 256B07
Vector Used pAC161
Line Availability only available from NASC (N424499)
Segregation Analysis 50:38:34
Confirmed for Hit At1g80480
Parent of DUPLO pair 2319
Parent of pair(s) none

Gene hit At1g80480

 
Sequence (A. th genome BLAST matches underlined)
>50-K014920-022-256-B07-8409
CTGATCCATGTAGAATTTCCCGGACATGAAGACCTTTACAATTGAATATATCCTGATACG
TCTTACTCATTCCCCACATTCTCTAAGCATACTAAATGAAAATGCCCCCTTTCCCAACCT
GTAGTCTCTATGACTATATGATCGAACTTTCCTTTCTTGGTATTGACTAATTCTCCAATC
ATCCTGACAAGATCACCCCTAACAGTGCAACAAAGGCAGCCATTGTTGAGCATCACAATA
TCCTCAGCTCCAATAGATTTAGAAGCAACAAGTGCCCCATCAATGTCAACTTCACCAAAC
TGAGAGAATTCACATGAAACATGAATTAGAAAGCAACACCATTATAACTGAATTCAGGCG
AGGATAATAAGCTAACCTCATTCTCAATCACGGCTATTCGCTTCCCATGATCTCTGGTCA
GTATATGATTCAGCAATGGTTGTCTGTGGAAAAACAAAACATTGCAGTATAATTAGTCCA
ACATTTCTTTTACTTAGCACGGCTAATTNTAAACCCTATGGGATCCT
GenBank Accession AL941270 [GenBank]
Graphic View Graphic view of gene At1g80480
Predicted Position of Insertion Chr1:30259771 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F5I6
Hit Gene Code At1g80480 [TAIR] [MIPS] [SIGnAL]
Gene Annotation plastid transcriptionally active 17
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23