SimpleSearch - Line and FST details


Line specific information

 
Line ID 257B03
Vector Used pAC161
Line Availability only available from NASC (N424591)
Segregation Analysis 50:50:34
Confirmed for Hit At2g03050
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g03050

 
Sequence (A. th genome BLAST matches underlined)
>18-K014921-022-257-B03-8409
TTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATTGATGATAGCAAG
GTGTTCTCTTTTTCCGCCGCCGTGTTTCTCCGCCGTGAGGATTAGATGTTTCGCCGGAGA
AACTTCAGATACTGGGATTCTATTCCGGGAGAAGCTTATTTACCTTCAAGACCTTAACGT
AGATCCTCACAAAGCTCTCCGAGTAAACCCATCTCTCCGTTCTGCTCCAATCTCCTCCGT
CGTCTCCGTCGAGACTCTACTCTCTTCCACCGGACTCTCAAGACCCGCCGTTGGTCGTAT
CCTCGACATGTTTCCAGATTTGTTAACTTCTGATCCTGAATCTGAAATCTTACCAGTTCT
TCGCTTCTTATCCAATGAGATTTCAATTTCAGAGCAAGACATACCTAAATCGATCTCCTC
GTTGTCCTCGATTGCTAATTTCATCTGTAGATTATCAGCTTCGTCCTGCATTAACGTTCC
TCAAAACCCTATGGGATC
GenBank Accession AL941389 [GenBank]
Graphic View Graphic view of gene At2g03050
Predicted Position of Insertion Chr2:900947 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T17M13
Hit Gene Code At2g03050 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Mitochondrial transcription termination factor family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL941388 [GenBank]


Last Updated on 14.10.2014 10:23