SimpleSearch - Line and FST details


Line specific information

 
Line ID 257G02
Vector Used pAC161
Line Availability only available from NASC (N424650)
Segregation Analysis 100:91:89
Confirmed for Hit At4g23550
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g23550

 
Sequence (A. th genome BLAST matches underlined)
>15-K014921-022-257-G02-8409
TTGATCCATGTANNGATTTCCCGGACATGAAGCCTTTACAATTGAATATATGGGTGAGGT
GGCTTATATGGACGAAGGAGACCTATGGGATCCTCACTATAGTGAGACTTATAACTCACG
CTGTAGGTATCTCATTTCGGTGTATGTCGTACGCTCCAAGCTGGGCTGTGTGCACGAACC
CCCCGTTAACCCGACCGCTGCGCCTTATCCGGTAACTATCGAATTGAGTCCAACCCGGTG
AGACACGACTTATCGCCACTGGCATCAGCCACTGGTAACAGGATTAACACACCGAGGTAT
GTAAGCGGTGCTACACATTTCTTGAAGTGGAGGCCTAACTACGGCTACACTATGGGATCC
TTCCTTTAGTGAGTATGGGATCCTC
GenBank Accession BX649804 [GenBank]
Graphic View Graphic view of gene At4g23550
Predicted Position of Insertion Chr4:12291809 - go to primer design
BLAST e Value 1e-13
Hit Clone Code (BAC ID) F9D16
Hit Gene Code At4g23550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY family transcription factor
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40