SimpleSearch - Line and FST details


Line specific information

 
Line ID 258B10
Vector Used pAC161
Line Availability only available from NASC (N424694)
Segregation Analysis 100:78:61
Confirmed for Hit At1g69810
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g69810

 
Sequence (A. th genome BLAST matches underlined)
>74-K014922-022-258-B10-8409
NTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATATATCCCGAGACC
ATTTCCGAACAGCAAGTTGACTTTTATCAGATGCAGTAAAACTGTATTAATTTCAGACAT
AAGAATTATATGGTAACTATATGTAAATATATAACAGAATCATATGATCATGAGATTAAT
TCTAACCGATTGAAACACCAGAAGGAGATTGAAAATAAAACAAGAATTAGAGAAATTTGT
GGTTTAAACGGTTAAATCGAGAAATAGTGTTTTGTTTTACCTTGTCAGATTCTGCCATAA
CACCATCGAAAGTTTGGAAGTATGAAACGGTCTCCTCTTTGATCATGCTATTATATGATT
CAGATGCGATCTTGAGATCAACTGGATCTGCTCTTTTTGTTTTTCTTCTTTACATCAAAA
AAAAAATTATTGGCGTTTTCTTTTGCCTAATTATGGGATCCTC
GenBank Accession BX649807 [GenBank]
Graphic View Graphic view of gene At1g69810
Predicted Position of Insertion Chr1:26278823 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T17F3
Hit Gene Code At1g69810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 36
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX649806 [GenBank]


Last Updated on 31.08.2016 09:40