SimpleSearch - Line and FST details


Line specific information

 
Line ID 258C03
Vector Used pAC161
Line Availability only available from NASC (N424699)
Segregation Analysis 50:47:34
Confirmed for Hit At2g43520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g43520

 
Sequence (A. th genome BLAST matches underlined)
>19-K014919-022-258-C03-8409
TTGATCCATGGTAGATTTCCCGGACATGAATACTGATTTATTTTACCACCGTGCTATTAT
ATCAGGGATATAAAGAGGCAAGTGGTTACTTTTCTTATCATACTGATCTCAACTCGTGAC
CCGTGGTTGTCATGATAATTTCTATGGGATCCTCCCTATAGTGAGACTATGGGCTCCTCC
GTTTCCGAGAGTTTGGGATCCTCCTTCTTGTAAGACGACACATAGCTAAACATTCATACT
CACTGTGGCTACACCATGGAAGCTCACAGAAGCTATATTACCGCCGGATAATGTTTTGGA
TACTAATATGACTTGATATCCTGTGTACGGGAGAAGCTAACAACCTAAACCGCAGCCCGC
GCCTCAAAGCCAAACTACCGATNCCTTGTTAGAACACACAAAACCCTAGACTCATACGGA
CTTTGGCCACACCATGAAAGCTTTGAGAAGCTAT
GenBank Accession AL941491 [GenBank]
Graphic View Graphic view of gene At2g43520
Predicted Position of Insertion Chr2:18068350 - go to primer design
BLAST e Value 2e-52
Hit Clone Code (BAC ID) T1O24
Hit Gene Code At2g43520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation trypsin inhibitor protein 2
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40