SimpleSearch - Line and FST details


Line specific information

 
Line ID 258G03
Vector Used pAC161
Line Availability only available from NASC (N424747)
Segregation Analysis 100:92:65
Confirmed for Hit At5g17030
Parent of DUPLO pair none
Parent of pair(s) 8298, 9783, 9796

Gene hit At5g17030

 
Sequence (A. th genome BLAST matches underlined)
>23-K014922-022-258-G03-8409
TGATCCATGTAGATTTCCCGGACTGAAGCACTTTCTTCAAGGGAAATGGGAAGAGGGTGA
AAGTACAGTGGAAACCTATGGGATCCTCCCTATAGTGAGAGNTTTTTGGCTCTGGGATCC
TCCCTACCTTGAGATGAGTCACTTTCATCTCTTGTGGCGACCAAACAAAGAGCGCTTTTC
TCTAGGCCAAGCCTTGGGCCATCCCCACGAGCTCTACATGAGGCTGTGGCACCACTCCTC
CAAAGGGAATGTACGCTACAGAAGCAGTGGACCGCTTCTCGATCCAAGCCAAGCAACCGT
GAGGATCGTGCACTATGGGATCCTCCC
GenBank Accession AL941543 [GenBank]
Graphic View Graphic view of gene At5g17030
Predicted Position of Insertion Chr5:5603546 - go to primer design
BLAST e Value 6e-46
Hit Clone Code (BAC ID) F2K13
Hit Gene Code At5g17030 [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-glucosyl transferase 78D3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g17060

 
Sequence (A. th genome BLAST matches underlined)
>23-K014919-022-258-G03-8409
NTTTTGATCCATGTAGCATTTCCCGTACATGAAGCTCTTTACAATTGAATATATAACTGT
ACTCAAATAAACTATCAAAGGATTCCAAAGTATTTGACTTCCACCACGCTCTCATGTTCT
CAGAGATATAAATCTAATAATACGATCGCAAAATAGGGAATATTTTTTTCTATGGGAGCC
TCCC
GenBank Accession AL941542 [GenBank]
Graphic View Graphic view of gene At5g17060
Predicted Position of Insertion Chr5:5610843 - go to primer design
BLAST e Value 7e-12
Hit Clone Code (BAC ID) F2K13
Hit Gene Code At5g17060 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ADP-ribosylation factor B1B
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 14.10.2014 10:23