SimpleSearch - Line and FST details


Line specific information

 
Line ID 259F08
Vector Used pAC161
Line Availability only available from NASC (N424836)
Segregation Analysis 100:97:74
Confirmed for Hit F10K1
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F10K1

 
Sequence (A. th genome BLAST matches underlined)
>62-K014916-022-259-F08-8409
CATGAATTTTATGAACTCTTGAAACACTCCGTGACTATAAGAGTGCGTCCATATGAGAAA
GTCTGATAGTTTATTACGGTACTTAATATACATACATGCAGATGGCATAACATTAATTCG
AATTCCAACTGAATCCTCCTAACCATGCGACGAGATAGACATCGTACGGGTCCTAGCTAG
CTTGAGAAAAAACCTTAAGATTTCCACATATCTATCGAATACTACCTNNGGGGGAGCTCC
CATCTAGTGAGAAGTTCACAACAAGTCATCGAATATGTGAATCATTCACAGCGAATGCTA
TGAAGACACTAATGGACACTTTGTCAGAACTTAGGAATGACTTCAAACTCTAACGTTGTG
GGACTGTCTCTACAGTGCGCCTATGGTCAGAAGAGGTGGCACAACTGAATCAACATCACA
CTAATATCGCCCAAGGAGCCTCGTGATACAGAGAGGTCAACGAGCTTCTTGCAAGCCAGC
AATGGCTTCCGGTTCTGATCGGGTCCTTTGCAAAATGGCCGAGCTATGGCTACTGGCTCC
TGATTACTAACCTTGGCCCATAAACCATCTGATGCTAAGATCAAGAACTCGTGGTGGGCG
ATTGATTCGGAGAAAAATAATCTCTGGT
GenBank Accession BX942911 [GenBank]
Graphic View Graphic view of sequence BX942911 of line 259F08
Predicted Position of Insertion Chr1:2197771 - go to primer design
BLAST e Value 9e-113
Hit Clone Code (BAC ID) F10K1
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL941650 [GenBank]


Last Updated on 31.08.2016 09:40