SimpleSearch - Line and FST details


Line specific information

 
Line ID 262F03
Vector Used pAC161
Line Availability only available from NASC (N425119)
Segregation Analysis 50:42:27
Confirmed for Hit F22D1 At5g23430
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F22D1

 
Sequence (A. th genome BLAST matches underlined)
>22-K014926-022-262-F03-8409
TTGATCCATGTAGATTNTCCCGGACATGAAGCACTTTGCATGACATCGCAACATATCGCA
GATCTGGCCCCATAGACCTCTTTACCTGAATTACCCACCATTCTATGGGATCCTCCATTC
ATTTGAGATCCTGCCTATAAACAGATCAAAATGATAATTTTGTAGTAGTTAAATGATATT
AAATATTGCGGAAGTTTTATTTTAATAACTAATCGTGTAGTTAATGTGAAGAGATTTTGG
GAAGATTGTCAAATATTTAATTCAAAGATTTTCTTTCTAATTATCAAAAACAATTATTAA
ATGCCAGTGGCAGCCACTGTAAATAAATTCCAACTCTATGGGATCCTCC
GenBank Accession AL942012 [GenBank]
Graphic View Graphic view of sequence AL942012 of line 262F03
Predicted Position of Insertion Chr5:7070310 - go to primer design
BLAST e Value 8e-101
Hit Clone Code (BAC ID) F22D1
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g23430

 
Sequence (A. th genome BLAST matches underlined)
>22-K014951-022-262-F03-8409
TTTTGATCCATGTAGCATTTCCCGGACATGAAGTCCTTTACAATTGACATATATCCTGTA
AAAGAATTTACCGGGAACCTTTTTTTTTATCTTTCTGTGTGTTAATGGATCTGATATGCA
ACTTGTCTTTACCTGGTTTGGGATTATAACAGCTGGAAAACTGCTGACCGAGTTTATATA
GTCATGAAGGGCAAATTCAAAGCCTATGGGATCCTCCTTTGAGTGAGAAAACTTATTTAT
ACCAAGGAAAAAATAGATAATAAATTTTGAGAAGTTGGTGACTATATATTACTTCACTTA
TTCAAGAAATTTAAACATGGTAAATGTTACTTTAAATGTTAAATGATGTATAAGAAATGT
AATGAAATTGAATAAATGTAGGTTTAAAGATGTTTTAATTAGTAAGACAAACCTATGGGA
TCCTCCCTTTAGGTGAGAGNNNCNCCCCCCCCTCCCACCCCACAACAGGCGCGAGATGGA
GCGGGGGACAGAGTATGATACCGGCACGCCAAGTCAGCACGACGCAAATCCCATCATACG
CCCGCCCCCCCCCCCATCATTTCCCTTCCCGCCCCCCCCCCGAAACCCGTTCATCGCGCT
TAGACCGCCCGCCCCCCGTGTCCCCCTTGGAGCGACGGCAGCAGAGCGGCGGCGCCGCGT
GAGGGGGGGCGAGGGGGGGCAACGACGGGGGTAGCGAGACGGAGGAGAGCAGAGGAGGAA
GAATTCCAGAGAGACGACGGGCGGCGGCGGACGGCCGCGCCGCGTCCCCCGCCCACGACA
GCCCCCCCCGGCTCCGGTAGCGCCCGACCCGCCCCCCGAGGCAGCCTACTCTGCCCACGG
GTGCCGACAGCAAGACAACAACAATC
GenBank Accession AL942013 [GenBank]
Graphic View Graphic view of gene At5g23430
Predicted Position of Insertion Chr5:7898390 - go to primer design
BLAST e Value 2e-43
Hit Clone Code (BAC ID) K19M13
Hit Gene Code At5g23430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transducin/WD40 repeat-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T23K3

 
Sequence (A. th genome BLAST matches underlined)
>22-K014951-022-262-F03-8409
TTTTGATCCATGTAGCATTTCCCGGACATGAAGTCCTTTACAATTGACATATATCCTGTA
AAAGAATTTACCGGGAACCTTTTTTTTTATCTTTCTGTGTGTTAATGGATCTGATATGCA
ACTTGTCTTTACCTGGTTTGGGATTATAACAGCTGGAAAACTGCTGACCGAGTTTATATA
GTCATGAAGGGCAAATTCAAAGCCTATGGGATCCTCCTTTGAGTGAGAAAACTTATTTAT
ACCAAGGAAAAAATAGATAATAAATTTTGAGAAGTTGGTGACTATATATTACTTCACTTA
TTCAAGAAATTTAAACATGGTAAATGTTACTTTAAATGTTAAATGATGTATAAGAAATGT
AATGAAATTGAATAAATGTAGGTTTAAAGATGTTTTAATTAGTAAGACAAACCTATGGGA
TCCTCCCTTTAGGTGAGAGNNNCNCCCCCCCCTCCCACCCCACAACAGGCGCGAGATGGA
GCGGGGGACAGAGTATGATACCGGCACGCCAAGTCAGCACGACGCAAATCCCATCATACG
CCCGCCCCCCCCCCCATCATTTCCCTTCCCGCCCCCCCCCCGAAACCCGTTCATCGCGCT
TAGACCGCCCGCCCCCCGTGTCCCCCTTGGAGCGACGGCAGCAGAGCGGCGGCGCCGCGT
GAGGGGGGGCGAGGGGGGGCAACGACGGGGGTAGCGAGACGGAGGAGAGCAGAGGAGGAA
GAATTCCAGAGAGACGACGGGCGGCGGCGGACGGCCGCGCCGCGTCCCCCGCCCACGACA
GCCCCCCCCGGCTCCGGTAGCGCCCGACCCGCCCCCCGAGGCAGCCTACTCTGCCCACGG
GTGCCGACAGCAAGACAACAACAATC
GenBank Accession AL942013 [GenBank]
Graphic View Graphic view of sequence AL942013 of line 262F03
Predicted Position of Insertion Chr2:368970 - go to primer design
BLAST e Value 8e-101
Hit Clone Code (BAC ID) T23K3
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40