SimpleSearch - Line and FST details


Line specific information

 
Line ID 263B01
Vector Used pAC161
Line Availability only available from NASC (N425165)
Segregation Analysis 24:19:14
Confirmed for Hit At2g46270
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g06490

 
Sequence (A. th genome BLAST matches underlined)
>02-K014927-022-263-B01-8409
TTCTGATCCATGGTAGATTTCCCGGACATGAAGCCCTTTACATGATGGTAATGTCGTATG
GCTTTGTTTTGTTTGGTATACGGTGATTTTAAATATATTAACAAATAGCTAACCAGTGGA
GTCGATTAACGCGCTTTTACAGATACTTCAAATTATTGTCTAAGACTTAATCGATCATTT
AAAGAGGCTATGGGATCCTCCCTTTAGTGAGATAAAAGGGTACTACTGGACGCTCTCTCT
GCAGCTCTTGATCCCCGAGTATGATTCAGGCGAAACCTTGTCCAAACATCTCCCCGAAGA
TGAGAGCGTTAGCCTAACTCCTCGTCAGCGTTTAAACACCATTCCATCTTACTCTCTCTC
TAAAAAGACCAGAGCGAAAAAGAGTTCATTTCTTTTTTTTGGGGGAAGGGAAACCCAAAA
AAAAAAAAAAAAAAACGGAGCCCCAAAACAATAACCCCGTCTTCAAACC
GenBank Accession AL942072 [GenBank]
Graphic View Graphic view of gene At5g06490
Predicted Position of Insertion Chr5:1978722 - go to primer design
BLAST e Value 7e-49
Hit Clone Code (BAC ID) MHF15
Hit Gene Code At5g06490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status unknown

Gene hit At2g46270

 
Sequence (A. th genome BLAST matches underlined)
>02-K014952-022-263-B01-8409
TTGATCCATGGTAGATTTCCCGGACCATGAAGCCTTTACAATAGAGTATATCCTGAACGT
CTGAGTGTTGGAGAGCAAATACGATGATACCCTTCTATGTCCCTATAGTTCTCACCAGCA
GCTCCCATCCCGCATGATACATGTATAAAGAGTCATTGATATATTGAGTGGGAAACCTTG
AGACCCTTCCTATGGGAAATAGCAGCGAGGAACCAAAGCCTCCTACCAAATCAGATAAAC
CATCTTCACCCCCGGTGGTATGTTGAACAGTTTCAAACCATAATTCCAAAGTCAATTTAG
TTTTTCTTAAATTCCTTATGCGTTGACTTGACTCTTGTTGATAGGATCAAACAAATGTTC
ATGTCTACCCTGATTGGGCAGCTATGCAGGTTAGTCTTTTTTTTATTACGCTCCAGTTAT
GCACTATGGGATCCTCCCT
GenBank Accession AL942073 [GenBank]
Graphic View Graphic view of gene At2g46270
Predicted Position of Insertion Chr2:19000726 - go to primer design
BLAST e Value 3e-128
Hit Clone Code (BAC ID) T3F17
Hit Gene Code At2g46270 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation G-box binding factor 3
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03