SimpleSearch - Line and FST details


Line specific information

 
Line ID 263F11
Vector Used pAC161
Line Availability available as T3 set from NASC (N425223)
Segregation Analysis 100:92:86
Confirmed for Hit At4g12020
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g12020

 
Sequence (A. th genome BLAST matches underlined) 
>86-K014927-022-263-F11-8409
TTTTGATCCATGTAGCATTTCCCGGAGCATGAAGCCTTTACACTTGAATATATCCTGCAA
ATAAAAAAAATTGTGTTCTTGATGCTGCTTGTGTACTGGAACTGTCATCTATGGGATCCT
CCCTATAGTGAGAAAATTTAATGTTATTACCTATGGCATCCTTCCTCA
GenBank Accession BX649809 [GenBank]
Graphic View Graphic view of gene At4g12020
Predicted Position of Insertion Chr4:7201949 - go to primer design
BLAST e Value 3e-14
Hit Clone Code (BAC ID) F16J13
Hit Gene Code At4g12020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37