SimpleSearch - Line and FST details


Line specific information

 
Line ID 264B04
Vector Used pAC161
Line Availability only available from NASC (N425264)
Segregation Analysis 100:85:62
Confirmed for Hit At2g31660
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g31660

 
Sequence (A. th genome BLAST matches underlined)
>26-K014989-022-264-B04-8409
TGTAGATTTCTTCTTCTTCTTCGTCATGCTCTTCTGAGATTCTCCCCTCCTCTAATTCAG
CTCTCTCTCTTGGTTGGGAATTTCAAATCGAATATCAACCACTGCCTCTGATCGTCATCA
AGGTTTACTCTGTTTAGTGTCCGGATTCTCAAACTCCACGGAGAATGGATCTGCATAGCC
TCGCTTTGATCCTCCGAACCGCCGCTCTTAGCCCTATTCCCGATGAGCGTAAAGTTTCTG
AGCAGCAACTCAATCAGGTTTCTCAGTTTCCACTTCAATTTCTCTTTCGATGTATTTACA
CGGTTGCTTGGTCGCGAGTTTGATTGTTCTTATTCTGCTATGGGATCCTCCCTTAAGNTG
AGAGGCNNNNGNNNNCNCNCTNTANNANNCTACACTNAATTGGTANCTCTATGGGATCCT
CCCTATAATGGAAGAGAA
GenBank Accession BX890913 [GenBank]
Graphic View Graphic view of gene At2g31660
Predicted Position of Insertion Chr2:13464405 - go to primer design
BLAST e Value 2e-150
Hit Clone Code (BAC ID) T9H9
Hit Gene Code At2g31660 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ARM repeat superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL942195 [GenBank] HE664380 [GenBank]


Last Updated on 14.10.2014 10:23