SimpleSearch - Line and FST details


Line specific information

 
Line ID 267D01
Vector Used pAC161
Line Availability only available from NASC (N425573)
Segregation Analysis 50:32:21
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g32340

 
Sequence (A. th genome BLAST matches underlined)
>04-K014992-022-267-D01-8409
TTTTGATCCATGTAGCATTTCCCGGACATGAANGCCTTTACAATTGAAGACCATTCTATA
ATCATGGGCTCTATATGCTATGGGATCCTCCCTATATGTAGAGAGGGCCAACATATCGCT
GATACCTGCCGTATCAAGCATAAGGACCCTGAATCCATTCTTGTTATTTAATACGCGCAT
TTTTACTCGAATTATCTTCTACCATAACTCTTACCGCTACCTTTCATACTGTCCATTACC
AATACCATACTACACAACCTTCACAGCCTCACGCGGAGTCGACGCCTACGACGATCAAAT
TCTAAACCTCATTCCAACGACAAACCGGAGCGTAAATGGGATCCCTCCATGGNNGAGGAT
NGCTTGGCTGATGAATTGAGTAGGTTAAAGGTGAAACAGAATTCCCATTCGGTGAATTTG
GAGGAGAAAGT
GenBank Accession AL942580 [GenBank]
Graphic View Graphic view of gene At1g32340
Predicted Position of Insertion Chr1:11666039 - go to primer design
BLAST e Value 1e-25
Hit Clone Code (BAC ID) F5D14
Hit Gene Code At1g32340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NDR1/HIN1-like 8
Insertion Classification TS2TE (5')
Confirmation Status unknown

Gene hit F9L11

 
Sequence (A. th genome BLAST matches underlined)
>04-K015000-022-267-D01-8409
TTTTTGATCCATGTAGCATTTCCCGGACATGAANGCCTTTACAATTGAATATATGGAATA
TATATCCTTTACTTTATGTTAATTATTTTTACCAAGCAAACAAATGGCCTAATTTTGGTT
GAGTTTATTTGTTTTCCTAACGAAGCAAATGACCTAATCGACACCAAAAGAAACCAAACA
AAAGTCTATTTAGACTATAGTCTATAGATTTTTTTAATATATATATTTATCAAAGCGGAT
ATCCGCAAATATTTAAAAAAAAAATCCGGATATTCTAAATTCCGGATATTATAAAATTTT
CAAACTCAAGCAATTATAAAATCAAGTTTTCGGGTAAAACGATTCGATTATCAAATATTT
TAATTTTTTGGGATTTTCGCTTCGTGCCCAAACCTATGGG
GenBank Accession AL942581 [GenBank]
Graphic View Graphic view of sequence AL942581 of line 267D01
Predicted Position of Insertion Chr1:11930463 - go to primer design
BLAST e Value 8e-101
Hit Clone Code (BAC ID) F9L11
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 07.07.2016 14:03