SimpleSearch - Line and FST details


Line specific information

 
Line ID 267D10
Vector Used pAC161
Line Availability only available from NASC (N425582)
Segregation Analysis 100:88:65
Confirmed for Hit At5g44290
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g44290

 
Sequence (A. th genome BLAST matches underlined)
>76-K015000-022-267-D10-8409
TTGATCCATGTAGATTTCCGGGACAAGAGGCTACTCACAATTGACTGGACTGGGTCTCTG
GGATTGTCCTCTGATATGAGACTCCCACCTGAATCTCTATATACGTGATTTACTTTCTGC
AACGCCCTGTTTTATGCTTGGTGAAATCAGGGAGCTGCCGGTCGTGTTCTTCCAGCATCT
GATCCACTTTTCTTGGCTGAGCCAGTAATGGACCGGACATGTACATCTTGTTATCCCCTG
AATCATACTATATCTCCAAAGAGAGAGAGAGAGATAAAGACAATGTAACTGAGAAATGAG
GAAAAAAATAGTCTCTTGAGATGACTTACCCAAGATGGGTCATTTGGGATTTTGGTTTGT
CTTTTACTATTATCCATAGTGTCAGCTCTGTTGAATGTTCTCAATTCCTTCCTTTGCTGA
TCCATCATTTGGTGATCTGACCCAACATAACCGCCTCCTTGTCCTGCTGAGTTAGCCCTA
TATGAAGGTATCCTATGGGATC
GenBank Accession CT026213 [GenBank]
Graphic View Graphic view of gene At5g44290
Predicted Position of Insertion Chr5:17840699 - go to primer design
BLAST e Value 7e-154
Hit Clone Code (BAC ID) K9L2
Hit Gene Code At5g44290 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CT026212 [GenBank]


Last Updated on 14.10.2014 10:23