SimpleSearch - Line and FST details


Line specific information

 
Line ID 268A08
Vector Used pAC161
Line Availability only available from NASC (N425640)
Segregation Analysis 50:46:44
Confirmed for Hit At4g21320
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g21320

Sequence (A. th genome BLAST matches underlined)
>57-K015061-022-268-A08-8409
NTGATCCATGTAGAATTTCCCGGACATAGAAGCCTTTACAATTGAAGTTCCTGAGGAAAC
TCTTCTACGATATGTACGTTTGATTAAGAACGGTGGTCTCAGAGCCAAACCAATGTTTGC
TGTGAAATTCAACAAGTCTGATATTCCTGGTAGGAATAGAGCATTTGGTTCCTATGTTGT
TCCAGAACCTCGGTCAAGCGGTAAGAAGAAACAACTATGGGATCCTCCCTATAGGGAGGC
TTATCTGACACCGGCGGCGTATCTCACACCGAAGGTGAAACCGCTATAGGCCCCTCCTTA
TATTGAGGACCGGACCTATGGGCGAATATGCAAGCATACCTTTCTTGCTTG
GenBank Accession AL942663 [GenBank]
Graphic View Graphic view of gene At4g21320
Predicted Position of Insertion Chr4:11341053 - go to primer design
BLAST e Value 8e-95
Hit Clone Code (BAC ID) T6K22
Hit Gene Code At4g21320 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Aldolase-type TIM barrel family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Charng et al. 2006, hsa32-1]


Last Updated on 14.10.2014 10:23