SimpleSearch - Line and FST details


Line specific information

 
Line ID 269D05
Vector Used pAC161
Line Availability available as T3 set from NASC (N425769)
Segregation Analysis 100:77:64
Confirmed for Hit At5g56740
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g56740

 
Sequence (A. th genome BLAST matches underlined) 
>36-K015069-022-269-D05-8409
NTGATCCATGTAGATTTCCCGGNACATGAAGCCTTTACAATTGAATACCACCACATATGA
CTTAGCAAGGCCTGTTAACGGCCCAAATGCAAGACCAATTCAAGTTTGTATTATTAGGTA
TTATTTATCTAATTAACGAAATATCAAATGAGGGCGTTTGGCCTATGGGATCCTCCCTAT
AGTGAG
GenBank Accession AL942817 [GenBank]
Graphic View Graphic view of gene At5g56740
Predicted Position of Insertion Chr5:22955738 - go to primer design
BLAST e Value 3e-57
Hit Clone Code (BAC ID) MIK19
Hit Gene Code At5g56740 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation histone acetyltransferase of the GNAT family 2
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL942817 [GenBank]


Last Updated on 10.06.2021 13:37