SimpleSearch - Line and FST details


Line specific information

 
Line ID 270C03
Vector Used pAC161
Line Availability only available from NASC (N425851)
Segregation Analysis 50:50:40
Confirmed for Hit At3g48890
Parent of DUPLO pair none
Parent of pair(s) 2115

Gene hit At3g48890

 
Sequence (A. th genome BLAST matches underlined)
>19-K015063-022-270-C03-8409
AAGCATTTAAATTGATATATGAGATATATATAATATCGTATTGATTAATTATCCACATTT
GCTTAGCTATATAAGTGTTACATGACATTTGAAAATCAACGTATTTGGAGAACATTGTTG
GTATGTAACCATGCTGCAGTTGGCTATGGGATCTCCNCTATAGTGAGANNANNAATANNN
NNATNNNNNNNTTNTNNNANGNCTTNTNCAANAATCAGAAATTTATAATAAAATATAA
GenBank Accession AL942929 [GenBank]
Graphic View Graphic view of gene At3g48890
Predicted Position of Insertion Chr3:18130516 - go to primer design
BLAST e Value 7e-15
Hit Clone Code (BAC ID) T21J18
Hit Gene Code At3g48890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation membrane-associated progesterone binding protein 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL942930 [GenBank] AL942929 [GenBank]


Last Updated on 31.08.2016 09:40