SimpleSearch - Line and FST details


Line specific information

 
Line ID 270E04
Vector Used pAC161
Line Availability only available from NASC (N425876)
Segregation Analysis 43:29:21
Confirmed for Hit At4g35190
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At5g65510 can not be ordered because the confirmation of this insertion failed.
Although the line exists, the insertion in F26G5 can not be ordered because the confirmation of this insertion failed.

Gene hit F17A8

 
Sequence (A. th genome BLAST matches underlined)
>84-K020162-022-270-E04t-8409
TCATACCGAGGACCAAAGTTTTGGGGTTTGGAGAATGCTCTATGGGATCCTCCCTATAGT
TAGAAGANCATCCTAACGTTCTTATCCTTATCGCTATGAGGATCCTCACTATAGTGAGCT
GCTATGGTATCCTCCCTATAGTGAGGAGNTNNNNGTATCNNAGTTANTTTTACCGGAATA
TGTTCCATCCAATACAATAAACTCAACCAAAATTTCTC
GenBank Accession FR806931 [GenBank]
Graphic View Graphic view of sequence FR806931 of line 270E04
Predicted Position of Insertion Chr4:6141944 - go to primer design
BLAST e Value 5e-13
Hit Clone Code (BAC ID) F17A8
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit F26G5

 
Sequence (A. th genome BLAST matches underlined)
>84-K020163-022-270-E04t-8409
AGTGTAATGATGCACATCCTGAAGCATCAAGAGAAGATACTACTATAATCACATGTCACA
ATCATACATATACATTAAGATTTGTTCAGGGTTTTCTTCATACCGAGGACCAAAGTTTTA
AGGTTTGGAGAATGCCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX530850 [GenBank]
Graphic View Graphic view of sequence BX530850 of line 270E04
Predicted Position of Insertion Chr3:15847821 - go to primer design
BLAST e Value 1e-57
Hit Clone Code (BAC ID) F26G5
Insertion Classification Genome Hit
Confirmation Status failed

Gene hit At5g65510

 
Sequence (A. th genome BLAST matches underlined)
>29-K015063-022-270-E04-8409
TATCATGAAATTTCCNGGACATGAAGCATTTACAATTGATATATGGTACTGTTCTTCTTG
CACATAGCGTTTAACAGATATAACTGTGAAATAGCTATATAACTGTTTAGACTTTATTTT
TCTCTATGGTATCGACCCTAAGATGAGATAAATCTGGCTCACTCGCAAGTTCCAGATTTA
AGTACCAAAAGACATCAAAGTTCTATGGGATCCTCCCTATAGAGAGATCTTTGAAAATCT
TTCATTTCACCTTCTATGGGGACCCCAATGCTGATGTCTGTATGATGCAATCTCTGTTTC
TTGATTGACATGTATTTGGACCCACTTTTGACCCTTTATTCCAATGCTGTTATATGACAA
TAATGACATGCATGCATATATTAATAAATACATGTGGTGTCAGACTAAACACTATGCATA
TATTCTTTTGCTATGGGATCCT
GenBank Accession CT026217 [GenBank]
Graphic View Graphic view of gene At5g65510
Predicted Position of Insertion Chr5:26187607 - go to primer design
BLAST e Value 3e-106
Hit Clone Code (BAC ID) K19O4
Hit Gene Code At5g65510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AINTEGUMENTA-like 7
Insertion Classification CDSi
Confirmation Status failed

Gene hit At4g35190

 
Sequence (A. th genome BLAST matches underlined)
>29-K015070-022-270-E04-8409
NTGATCCATGTAGAATTTCCCGGACATGAAGCACTTACAATTGAATATATCCTGAAACTT
TAGGAATCGATCCTGTATTAGAGGATATAATTATGAGAAATATTAAAGTTTGTTGTTTTC
TGGGGTTTCTTTTGTCCCTCTTGAAGAAACCACCTGTATCAAACTTTCAACAAACTGATT
CCACCAAAATGCACAACCTGAAAATATCAGCACTGAATCTTGGCCAATTCTTTGTAGAAA
ATGAACACACAATCTCTTGTGCTGTATACCAAAGAGTTCATTCCCTCAATTATGAAGATC
AGAAAGAACAACACAAACCATCACAATGATATTTTGTGGTTGCAGCGGGATCCAACTTTC
CCCAAATCTTACGGAGCAGGAATAGGCTGTTCCATTGGGTCGGAGAAACTCTCTGCTCTG
ATGAATTTGATATATAAATATATAATTGATACTATATTTTTTGGTACCGAAAGACTTTTT
AATTGAACCCGATAAAATCAACTTCAAAAACTTTAATTAAACCGAACCTGAACCGGTTTT
GACTATGAAACCGAGATATATAGTGGCTTTCGGGTCCCAGTTTCTTTGGGTCCTATGGGA
TCCT
GenBank Accession AL942964 [GenBank]
Graphic View Graphic view of gene At4g35190
Predicted Position of Insertion Chr4:16748109 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T12J5
Hit Gene Code At4g35190 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Putative lysine decarboxylase family protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40