SimpleSearch - Line and FST details


Line specific information

 
Line ID 270G01
Vector Used pAC161
Line Availability only available from NASC (N425897)
Segregation Analysis 50:27:15
Confirmed for Hit At1g49780
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g49780

 
Sequence (A. th genome BLAST matches underlined)
>07-K015070-022-270-G01-8409
NTTTGATCCATGTAGACTTTCCCGGACATGAAGCACTTTACAATTTACAATTTTCCCGTT
CGAAACTACGACGACCTAATTAAAATATGACGTATATATAGCCAACATTCATATGTATGA
CATATTTTCGAGTCTCCGATATATTACATTCTGTGTTATTAATTTATCCTATGGGATCCT
CCCTATAGTAGAGACAACAACGCTCCCGCCGCGTACTCCGTCGCTCTATCTGAAACTCTT
AATATCGTCTTCACCATTAGCGGCACCGTCAAAGCATGCTCACCAAACGCAGCACATCCT
TCTGGTAATCGGCAAAGAAGCTCCACTGTCGCTAAACCTCGCTCCGTATCACACCTATCG
AAATCCGCCGCGAGACGGTCGATTAAAATCCCCGGAGCTCCGGCGGAGATCACTATGGGA
TCCTCC
GenBank Accession AL942988 [GenBank]
Graphic View Graphic view of gene At1g49780
Predicted Position of Insertion Chr1:18429095 - go to primer design
BLAST e Value 3e-119
Hit Clone Code (BAC ID) F14J22
Hit Gene Code At1g49780 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation plant U-box 26
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40