SimpleSearch - Line and FST details


Line specific information

 
Line ID 272G02
Vector Used pAC161
Line Availability only available from NASC (N426090)
Segregation Analysis 50:42:28
Confirmed for Hit At1g69580
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g06345

 
Sequence (A. th genome BLAST matches underlined)
>15-K015096-022-272-G02-8409
CTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTAATGAAAGCGTAACAAACTCTCG
CTGGCTACTCATCTTCAAATCTCGGCATGGATTTTGCGAGGACCGAGCTCACTATGGGAT
CCTCCTATNAGTGAGAANNNNNCNNNCCNNNNCGAANATGTTCTTGGCCACCCTCTATTG
ATGGGAGTCCGGCTGTTCTAAAGCCGGCCAAGGGTGATGAACGAAATGTGAACCCTTGTC
TCGCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL943231 [GenBank]
Graphic View Graphic view of gene At3g06345
Predicted Position of Insertion Chr3:14196869 - go to primer design
BLAST e Value 4e-35
Hit Clone Code (BAC ID) F21A14
Hit Gene Code At3g06345 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation miRNA
Insertion Classification TS2TE
Confirmation Status unknown

Gene hit At1g69580

 
Sequence (A. th genome BLAST matches underlined)
>15-K015091-022-272-G02-8409
AACTCTCGCTGGCTACTCATCTTCAAATCTCGGCATGGATTTTGCGAGGACCGAGCTCTC
TATGGGATCTTCCCTATAGTGAGCAAGACTATCTCGAATTTCATCTGAACTTCCATCAGC
ATTAGTGAAGCCTCTGTGCACTGTACCTCTATGCTGCCCTTGAACAAACAATTAGTTATC
GACGTTATCTAGGGTCTATCTACAAAAGACCATGTGAGTTACTAATCGTTACTCGGAATC
TGGAATGCTGTTGACGTCGGCGACACTGCAGCCTCGGAGATCTCTTGAATCGATTTTACT
CACAACTTCTTGATTCTCTGATGCACAGGAAACTGCTCATCGAGAAACAAAACATATTTT
AACCTAATTGGGACCATCAGAGTCCGAAGTCAAGAATTTGTTTCTATCTTTTCTCTAAAA
ACATTATCAATGTTAATATTTGATCAGAAAACATCAAACCTTCTATGGGATCCTCCCTAT
AGTGAG
GenBank Accession AL943230 [GenBank]
Graphic View Graphic view of gene At1g69580
Predicted Position of Insertion Chr1:26173052 - go to primer design
BLAST e Value 2e-92
Hit Clone Code (BAC ID) F24J1
Hit Gene Code At1g69580 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Homeodomain-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40