SimpleSearch - Line and FST details


Line specific information

 
Line ID 274B08
Vector Used pAC161
Line Availability only available from NASC (N426228)
Segregation Analysis 100:89:78
Confirmed for Hit At3g10210 At1g06180
Parent of DUPLO pair none
Parent of pair(s) 3178, 3351

Gene hit At3g10210

 
Sequence (A. th genome BLAST matches underlined)
>58-K015094-022-274-B08-8409
TCGTGTCTCTCTCAACCGCTACGAAAACAGATGGGTCTCATAGTACATTTGCTCTTTGTT
GAGCTATGGGATGCCTCCCTATCATGTGAGCTTCCAGTACAGTCTGCAATGTTGAAAGAG
ATATTGTTTTGACAAAACAGTTAAGTCCACAGTTGTTGATTCTAAAGTAATCTATGGGAT
CCTCCCTTAAGTGAG
GenBank Accession BX890925 [GenBank]
Graphic View Graphic view of gene At3g10210
Predicted Position of Insertion Chr3:3160534 - go to primer design
BLAST e Value 6e-40
Hit Clone Code (BAC ID) F14P13
Hit Gene Code At3g10210 [TAIR] [MIPS] [SIGnAL]
Gene Annotation SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g06180

 
Sequence (A. th genome BLAST matches underlined)
>58-K015098-022-274-B08-8409
NTGATCCATGTAGATTNTCCCGGACATGATAGCACTTTACAATTGAATATATCCTGTAAT
GAGTAACTTGACTGTAGATTAACAATTTTCTCTTTGTATATGTGTTGCTTTTGTCAATAT
GCGAAATTTTATATCTTTGTGGGGCAGAGAACTGATAAGATTCCAACCCGTGATTGCCTT
TGTCCATTAAATAATTTCAATTTTTTACTTTCCTCTAATTATACTTTTTATTCACTATGG
GATCCTCCCTTAAGTGAGANNNCCCNNCNNAGNATCCCCACTCTGCGTACGAGAGATATA
GCTTGGCGATGAAGCGAAATCCGGGCAAGCGCGCCTTCCGGTGTATAGGAGCCTTCGCAA
GAGTATCGGAGCGTGCCTCCCTTCCGGTCGTCCCGAAAAGGCGGCCCACGCGACGCCCCC
CTACACTATAAGATCGCCCCCGGAGGAGAAGAACCCGCCACAGCACAACCCGGCGCCAAC
AAAGGAGAGCGAGGGCGCAACCCCAAGCATATGCCGGCTCTCGCCAGCGAACTCACCGCC
CCTACGCCCGCAGAAAAGGCGGCAG
GenBank Accession AL943406 [GenBank]
Graphic View Graphic view of gene At1g06180
Predicted Position of Insertion Chr1:1890261 - go to primer design
BLAST e Value 2e-80
Hit Clone Code (BAC ID) F9P14
Hit Gene Code At1g06180 [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 13
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23