SimpleSearch - Line and FST details


Line specific information

 
Line ID 274G12
Vector Used pAC161
Line Availability only available from NASC (N426292)
Segregation Analysis 100:82:62
Confirmed for Hit At1g73670
Parent of DUPLO pair none
Parent of pair(s) 1152

Gene hit At1g73670

 
Sequence (A. th genome BLAST matches underlined)
>95-K015094-022-274-G12-8409
NTGATCCATGTAGATTTCCTGGACAAGCCGCCAAGTCTCGTCGAGTCGCGTTGTCTGGTT
GAAGGTGACCGATGCGGTTGGGGACGCCCTACCGCTGCGCTGAATGCATTTCCTGGGGAC
TGCAATCCGTCTAAAAATATAGGATGGGATCGCTCGGTCAGGAGAATCCTTGGATATCGT
TCAGGAGACCCACGCCGCGCTGGAGCGCATATCGCTGGATTAACGGCTGGAATCTGACTA
TTGAAACACAGTGCATCTGAGCGGACAATACTTCTAAGACCGTAACAATACGGGTGATGT
CGTCAGCCGGCGATACAGGCCTCGCGTCCGGATGGCTGTCGGCCGGTCCCACATTCACTA
CTTTTGATCCGACTCTCACCATTTGAATCGACGTCCCGACAGCGCCGTAGTCGTCTATAC
GATGATGATTTGAATAAGCTTACCGATCCGTCTAAGCTAAGACAGATTAAGGTTCAGCAA
CGAAATCACTTACCTATGGAAAAGAAGGTAGATTTTGTTTCCAATTTTGATATCTATGGG
ATCCT
GenBank Accession BX942916 [GenBank]
Graphic View Graphic view of gene At1g73670
Predicted Position of Insertion Chr1:27700350 - go to primer design
BLAST e Value 1e-50
Hit Clone Code (BAC ID) F25P22
Hit Gene Code At1g73670 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation MAP kinase 15
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR807018 [GenBank]


Last Updated on 31.08.2016 09:40