SimpleSearch - Line and FST details


Line specific information

 
Line ID 276A02
Vector Used pAC161
Line Availability only available from NASC (N426402)
Segregation Analysis 50:47:31
Confirmed for Hit At3g57520
Parent of DUPLO pair none
Parent of pair(s) 1398, 79973

Gene hit At3g57520

 
Sequence (A. th genome BLAST matches underlined)
>09-K015120-022-276-A02-8409
NTGATCCATGTAGATTNTCCCGGACATGAAAGCCTTTACAATTGAATATATCCTGTAGAT
ATGAAACAAATATGTATATTTCCCGGCAGTCACATCTGTGTAGAAAGCGTCCCATGTGCA
CCAGCCAAACCAGTCTATGGGATCCTCCCTATAGTGAGAANANGNAAAGAACATGATGAA
ATGGTGTAAAATTAAATTGAATTCTTGCAGTGATCAACGACATGAAGAGTAGATTCTTCT
TGATATTATGACTATAAAGAAATGTGATAATGTGTGTACTAACACAGCATGTGAAAAGAA
AGATGGCGATATACTAAAATAATATAACCTTAATGGTGATGTAAACGAGACATACAAGAA
TAATTCGGGTATTAAGCTAACATAGTGTATAGATCGTTTGATGAGTTTAAAGGGATTGGT
TTAAACATGAACATAAACAAGGTGAGTTCCCTGGCTA
GenBank Accession AL943645 [GenBank]
Graphic View Graphic view of gene At3g57520
Predicted Position of Insertion Chr3:21291628 - go to primer design
BLAST e Value 5e-22
Hit Clone Code (BAC ID) T8H10
Hit Gene Code At3g57520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation seed imbibition 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03